27611: Kursusplan for forår 2011

From teaching
(Redirected from Course27611Spring2011)
Jump to: navigation, search

Generel information

Undervisere

Hjælpelærere

  • Ulrich Johan Kudahl
  • Anne Gøther Bresciani

Indhold

I dette kursus er der lagt en stor vægt på praktisk anvendelse af de bioinformatiske værktøjer. En typisk lektion vil blive indledt med en teoretisk gennemgang af dagens emne (incl. nogle mindre øvelser/gruppearbejde) på en lille times tid, og resten af tiden vil blive brugt til praktiske øvelser på computer.

Pensum

Udleverede noter og øvelsesmateriale: Der en ikke en formel lærebog - der vil løbende blive udleveret kompendiemateriale - typisk i form af PDF filer på hjemmesiden.

Computere

I skal SELV medbringe bærbare computere der kan kobles til DTU's trådløse netværk. Typen af computer/Operativ System er ikke vigtigt - Windows, Mac og Linux vil alle virke fint.

Software:

  1. En moderne Internet Browser (fx. Internet Explorer, FireFox eller Safari).
  2. JAVA: JAVA kan hentes gratis her: http://www.java.com - ofte vil det allerede være installeret på din computer.
  3. JEdit: I kurset vil vi flere gange bruge JEdit til at kigge på tekst-baserede sekvensfiler - du kan med fordel installere den før første kursus-gang (gratis program): http://www.jedit.org.

Hvor og hvornår

Kurset består af forelæsning + efterfølgende øvelser. Forelæsninger afholdes tirsdage fra 13:00-14:00 (circa) i bygning 208, auditorium 51. Øvelserne afholdes efterfølgende i rum 112 & 118 i bygn. 210.

Første undervisningsgang er tirsdag den 1. februar.

Afleveringer

Som træning til den computer-baserede eksamen, skal hver gruppe skrive en "log bog" med svar på de spøgsmål der stilles i øvelserne (man må gerne skrive på dansk selvom teksten i øvelserne er på engelsk). Efter øvelsen skal I upload'e jeres svar til CampusNet (Kursus 27611 -> Afleveringer).

I kan med fordel bruge en helt almindelig tekst-editor (fx. JEdit som vi introducerer første dag), og ikke bruge en masse kræfter på fancy formatering. Det vigtige er at adskille de enkelte svar, så det er let at læse. Et eksempel kunne være:

   Svar på Multiple Alignment øvelse
   ---------------------------------
   Af: Rasmus Wernersson (v18013)
   
   Spørgsmål 1
   -----------
   Fasta fil:
   
   >goat_alpha_globin_II
   ATGGTGCTGTCTGCCGCCGACAAGTCCAATGTCAAGGCCGCCTGGGGCAAGGTTGGCAGCAACGCTGGAG
   CTTATGGCGCAGAGGCTCTGGAGAGGATGTTCCTGAGCTTCCCCACCACCAAGACCTACTTCCCCCACTT
   CGACCTGAGCCACGGCTCGGCCCAGGTCAAGGGCCACGGCGAGAAGGTGGCCGCCGCGCTGACCAAAGCG
   GTGGGCCACCTGGACGACCTGCCCGGTACTCTGTCTGATCTGAGTGACCTGCACGCCCACAAGCTGCGTG
   TGGACCCGGTCAACTTTAAGCTTCTGAGCCACTCCCTGCTGGTGACCCTGGCCTGCCACCACCCCAGTGA
   TTTCACCCCCGCGGTCCACGCCTCCCTGGACAAGTTCTTGGCCAACGTGAGCACCGTGCTGACCTCCAAA
   TACCGTTAA
   >xxx_yyy_qqq
   ATAGATAGT ....
   
   
   Spørgsmål 2
   -----------
   2a): xxxx yyyy zzzz
   2b): ddd jjj uuu


NB: Afleveringerne har ikke nogen inflydelse på jeres karakter - det er rent øvelse i brug af det system vi også skal bruge til eksamen.

CampusNet

Link til CampusNet gruppe for dette års kursus: 27611 F11

Løbende evaluering og feedback

Kursus 27611 på Bio-Evaluering.dk

Lektionplan

Tirsdag 1/2 - Taksonomi databaser

Lektion: Introduktion til kurset, Evolution & Taksonomi. - Rasmus Wernersson.
Pensum: Brief Introduction to Evolutionary Theory - Skrevet/redigeret af Anders Gorm Pedersen.
Slides: (Bliver lagt på CampusNet - under "fildeling")
Øvelser:
  1. JEdit - (Svar til øvelsen)
  2. Taxonomi databaser - (Svar til øvelsen)
AVANCERET EMNE (Ej pensum):
Phone 34.gif Textfiler på binært niveau (Video forelæsning, ~20mb, mpeg4 - Indlæst af Rasmus Wernersson, 2010)
Baggrundsmateriale:...
"Hvad er Bioinformatik?" - oversigtsartikel (PDF).

Tirsdag 8/2 - GenBank

Forelæsning: Biologisk information, DNA struktur og sekventering, søgning i Genbank - Rasmus Wernersson.
Pensum: DNA sequencing tutorial - kilde: IDT Tech Vault
Udleveret materiale: "Base-calling" øvelse [PDF], GenBank + FASTA format [PDF]
Slides: på CampusNet - (under "fildeling")
Øvelse: Brug af GenBank databasen - (svar til øvelsen)
Baggrundsmateriale:
Phone 34.gif mRNA splicing (YouTube).
Oversigt over eukaryot gen-struktur (PDF).

Tirsdag 15/2 - UniProt

Forelæsning: Proteiner: data og databaser - Henrik Nielsen / Rasmus Wernersson.
Pensum: Virtual Ribosome - software artikel (PDF).
Slides: (bliver lagt på CampusNet)
Udleveret materiale: Protein, sekvens og strukturniveauer [PDF]
Øvelse: Translation (svar) & Proteindatabaser (svar).
Baggrundsmateriale:
Phone 34.gif Aminosyrer og Proteiner - Kort videoforlæsning (16 min) med en genopfriskning af de vigtigste facts ang. aminosyrer og proteiner (Indlæst af Thomas Nordahl Petersen, 2010).

Tirsdag 22/2 - Parvis Alignment

Forelæsning: Parvis alignment - Rasmus Wernersson/Anders Gorm Pedersen.
Pensum: Side 35-55 i Immunological Bioinformatics (PDF - på CampusNet: Fildeling -> Uddrag af lærebog).
Slides: (På CampusNet).
Handout øvelse: Alignment scores
Øvelse: Parvis alignment - svar: Parvis alignment svar.
AVANCERET EMNE (Ej pensum):
Phone 34.gif Video-klip: (Optaget i 2008): Detaljeret gennemgang af Dynamisk Programmering. - Mac/Windows (QuickTime/Mpeg4).
Ekstra materiale:
Phone 34.gif Optaget forelæsning: (kan bruges om reminder ang. dagens pensum - er på engelsk) Pairwise alignments + BLAST, Ander Gorm Pedersen 2010
login: viewer@cbs.dtu.dk - pass: jeglurer.
Starter med parvis alignment (dækker også dynamisk programmering) - bruger samme handout øvelse som I selv arbejdede med til vores forelæsning.

Tirsdag 1/3 - PDB & PyMol

Forelæsning: Protein 3D struktur - Thomas Holberg Blicher / Thomas Nordahl Petersen
Pensum: Protein Structure (Wikipedia - frosset version) - Link til "Live" version: http://en.wikipedia.org/wiki/Protein_structure
Bonus video forelæsning: Phone 34.gif Online video forelæsning (2010), Thomas Holberg Blicher
Slides: På CampusNet
Links til avancerede kurser:
Øvelse: Visualisering af proteinstrukturer i PyMol - svar: PDF

Tirsdag 8/3 - Malaria vaccine

Opsamlende computerøvelse med de emner der er gennemgået indtil videre
Design af malaria vaccine - Henrik Nielsen & Rasmus Wernersson (øvelse af Thomas Salhøj Rask og Henrik Nielsen).
Slides: På CampusNet
Øvelse: Malaria vaccine udvikling (svar).

Tirsdag 15/3 - BLAST

Forelæsning: BLAST: Introduktion til BLAST - Rasmus Wernersson.
Pensum: sektion 3.2.5 -> 3.3 (dvs. side 47 - 52) i Immunological Bioinformatics (PDF - på CampusNet: Fildeling -> Uddrag af lærebog).
Slides: (På CampusNet).
Øvelse: BLAST (NYT LINK) - Svar til øvelsen: Blast svar
Ekstra materiale:
Phone 34.gif Optaget forelæsning: (kan bruges om reminder ang. dagens pensum - er på engelsk) Pairwise alignments + BLAST, Ander Gorm Pedersen 2010
login: viewer@cbs.dtu.dk - pass: jeglurer.
BLAST delen starter ca. 1:05 inde i optagelsen.

Tirsdag 22/3 - Multiple Alignments

Phone 34.gif Optaget forelæsning: Multiple Alignments, Anders Gorm Pedersen 2010
login: viewer@cbs.dtu.dk - pass: jeglurer
Pensum: RevTrans (artikel, PDF)
Handout: Lokalisering af CDS navne i GenBank (PDF)
Slides: På CampusNet.
Øvelse: Multiple Alignment - Svar : Multiple Alignment svar

Tirsdag 29/3 - Fylogenetiske træer

Forelæsning: Fylogenetiske træer - Rasmus Wernersson / Anders Gorm Pedersen.
Pensum: "Introduction to Treebuilding" (PDF på Campusnet). Evolutionary trees (minus afsnittet "How to reconstruct an evolutionary tree").
Udleveret materiale: handout øvelse Rekonstruktion af afstandstræ
Slides: På CampusNet.
Software til installering: FigTree tree-viewer
Øvelse The Phylogeny of HIV Svar: PDF

Tirsdag 5/4 - LOGO-plots & vægtmatricer

Forelæsning: LOGO'er og vægt-matricer - Ole Lund / Henrik Nielsen.
Pensum: Side 68-80 i Immunological Bioinformatics (PDF - på CampusNet: Fildeling -> Uddrag af lærebog).
Supplerende pensum: Konstruktion af Logo plots - Hand out
Handouts til forelæsning:
Slides: På CampusNet.
Øvelse:' Sequence logos and weight matrices Answers: Answers to exercise

Tirsdag 12/4 - PSI-BLAST

Lektion: PSI-BLAST - Thomas Nordahl Petersen.
Pensum: Samme som sidste uge.
Slides: På CampusNet.
Handouts til forelaesning: Alignment using sequence profiles
Øvelse: PSI-BLAST - Svar til øvelsen: PSI-BLAST answers

Tirsdag 19/4 - Påskeferie

Påskeferie

Tirsdag 26/4 - Forudsigelsesmetoder

Forelæsning: Introduktion til forudsigelsesmetoder - Morten Nielsen
Slides: På CampusNet.
Handouts til forelæsning: Prediction using artificial neural networks. - Svar: Answers to Prediction using artificial neural networks - på Campusnet.
Øvelse: Training of a bioinformatics prediction method. Svar på Campusnet.

Tirsdag 3/5 - Gamle eksamenssæt

Gamle eksmenssæt - Henrik Nielsen mfl.
Sidste års eksamen:

Tirsdag 17/5 - Spørgetime

Spørgetime - Henrik Nielsen mfl.

Eksamen

Torsdag 26/5

EKSAMEN 2011:
  • NB: der åbnes først for adgang fra klokken 15:00 den 26/5 2011.
  • Genopfrisk (reload - ofte F5 under Windows) denne side for at se link'et til eksamensopgaverne
SOMMEREKSAMEN 2011: SOMMEREKSAMEN 2011

Tjekliste til computere

Se her om din computer har alt det software der skal bruges til eksamen: Tjekliste til computere 27611

Linksamling

Samlet oversigt over de websites vi har brugt i kurset: Linksamling for 27611