27611: Kursusplan for forår 2015

From teaching
Jump to: navigation, search

Generel information

NB: Dette er en foreløbig kursusplan; ændringer kan forekomme!

Undervisere / forelæsere

Assistenter ved øvelser

  • Astrid Zedlitz Johansen — hjælpelærer.
  • Trine Bladt — hjælpelærer.
  • Kosai Al-Nakeeb — PhD-studerende.
  • Kasper Nielsen — Postdoc, vikar for Bent i februar.
  • Emil Tosti — hjælpelærer, vikar for Astrid 21/4.

Indhold

I dette kursus er der lagt en stor vægt på praktisk anvendelse af de bioinformatiske værktøjer. En typisk lektion vil blive indledt med en teoretisk gennemgang af dagens emne (incl. nogle mindre øvelser/gruppearbejde) på en lille times tid, og resten af tiden vil blive brugt til praktiske øvelser på computer.

Se i øvrigt kursusbasen om 27611.

Pensum

Udleverede noter og øvelsesmateriale: Der en ikke en formel lærebog. Der vil løbende blive udleveret kompendiemateriale; typisk i form af PDF filer på hjemmesiden. Vær opmærksom på at alle øvelsesvejledninger er pensum — og det gælder også svarene til øvelserne, som bliver lagt på hjemmesiden efter hver øvelsesgang!

Computere

I skal SELV medbringe bærbare computere der kan kobles til DTU's trådløse netværk. Typen af computer/Operativ System er ikke vigtigt — Windows, Mac og Linux vil alle virke fint.

Til øvelserne i "PDB & PyMol" samt "Malariavaccine" skal I medbringe en mus. Musen skal have tre knapper, hvoraf den midterste skal være et scroll-hjul.

Software:

  1. En moderne Internet Browser (fx. Google Chrome, FireFox, Opera, Safari eller Internet Explorer). NB: Du skal have enten FireFox, Chrome eller Opera på dit system, da Internet Explorer (Windows) og Safari (Mac) kan have knas med visse bioinformatik-websites.
  2. JAVA: JAVA kan hentes gratis her: http://www.java.com — som regel vil det allerede være installeret på din computer.
  3. JEdit: I kurset vil vi flere gange bruge JEdit til at kigge på tekst-baserede sekvensfiler — du kan med fordel installere den før første kursus-gang (gratis program): http://www.jedit.org.

Øvrig software installeres i løbet af øvelserne.

Hvor og hvornår

Kurset består af forelæsning + efterfølgende øvelser, begge dele tirsdag eftermiddag. Forelæsningerne afholdes fra 13:00-14:00 (cirka) i bygning 208, auditorium 51. Øvelserne afholdes efterfølgende i bygning 210, holdlokalerne 042, 048, 066 og 068.

Første undervisningsgang er tirsdag den 3. februar.

Afleveringer

Som træning til den computer-baserede eksamen, skal hver gruppe skrive en "logbog" med svar på de spørgsmål der stilles i øvelserne (man må gerne skrive på dansk selv om teksten i øvelserne er på engelsk). Efter øvelsen skal I uploade jeres svar til CampusNet (Kursus 27611 → Opgaver).

Det er muligt at aflevere som en gruppe.

I kan med fordel bruge en helt almindelig tekst-editor (fx. JEdit som vi introducerer første dag), og ikke bruge en masse kræfter på fancy formatering. Det vigtige er at adskille de enkelte svar, så det er let at læse. Et eksempel kunne være:

   Svar på Multiple Alignment øvelse
   ---------------------------------
   Af: Rasmus Wernersson (v18013)
   
   Spørgsmål 1
   -----------
   Fasta fil:
   
   >goat_alpha_globin_II
   ATGGTGCTGTCTGCCGCCGACAAGTCCAATGTCAAGGCCGCCTGGGGCAAGGTTGGCAGCAACGCTGGAG
   CTTATGGCGCAGAGGCTCTGGAGAGGATGTTCCTGAGCTTCCCCACCACCAAGACCTACTTCCCCCACTT
   CGACCTGAGCCACGGCTCGGCCCAGGTCAAGGGCCACGGCGAGAAGGTGGCCGCCGCGCTGACCAAAGCG
   GTGGGCCACCTGGACGACCTGCCCGGTACTCTGTCTGATCTGAGTGACCTGCACGCCCACAAGCTGCGTG
   TGGACCCGGTCAACTTTAAGCTTCTGAGCCACTCCCTGCTGGTGACCCTGGCCTGCCACCACCCCAGTGA
   TTTCACCCCCGCGGTCCACGCCTCCCTGGACAAGTTCTTGGCCAACGTGAGCACCGTGCTGACCTCCAAA
   TACCGTTAA
   >xxx_yyy_qqq
   ATAGATAGT ....
   
   
   Spørgsmål 2
   -----------
   2a): xxxx yyyy zzzz
   2b): ddd jjj uuu

Vær venlige ikke at kopiere opgaveteksten i besvarelsen. Opgaveafleveringen på CampusNet har et system til detektion af plagiering, som giver udslag hvis der står en kopi af opgaveteksten i besvarelsen.

NB: Afleveringerne har ikke nogen indflydelse på jeres karakter — de er ment som en øvelse i brug af det system vi også skal bruge til eksamen. De er desuden en måde for os til at kontrollere forståelsen af undervisningen: hvis der er en bestemt fejl, som rigtig mange har lavet, kan vi måske forklare det bedre til næste undervisningsgang.

Eksamen

Eksamen i 27611 er elektronisk — d.v.s. at I skal medbringe egen computer og at I ikke får udleveret opgavesættet på papir. Opgavesættet kommer til at ligge som en PDF-fil på CampusNet. Afleveringen foregår også på CampusNet, lige som opgaveafleveringerne i løbet af kurset.

Eksamen er med alle hjælpemidler og åbent internet. I må gerne medbringe bøger, artikler o.lign. Desuden har I via internettet adgang til alle de materialer, vi har brugt under kurset. I må også gerne søge information på Google, Wikipedia o.s.v. — I må bare ikke kommunikere med andre via email, Facebook, chat el.lign.

Ligesom i opgaveafleveringerne må vi bede om at man ikke kopierer opgaveteksten i besvarelsen. På den måde undgår man at besvarelsen bliver automatisk markeret som plagiering.

Når man afleverer sin eksamensbesvarelse på CampusNet, får man en kode som skal afleveres på papir til eksamensvagten. Det er meget vigtigt at koden bliver afleveret korrekt, ellers kan besvarelsen ikke godkendes. Koden bliver ændret, hvis man uploader en ny version af sin besvarelse; den er således en kontrol af, at man ikke har ændret i sin besvarelse, efter at man har forladt eksamenslokalet.

CampusNet

Link til CampusNet gruppe for dette års kursus: https://www.campusnet.dtu.dk/cnnet/element/index.aspx?elementid=476647

Løbende evaluering og feedback

Vi modtager meget gerne kommentarer, forslag, kritik, ros mm. til undervisningen og undervisningsmaterialerne nårsomhelst. Du kan gøre dette ved at oprette en ny tråd på Konferencen i CampusNet. Du kan også svare på andres indlæg. Hvis der er et indlæg, du er enig i, så skriv meget gerne kommentaren "Enig!", så vi ved at der er flere, der mener det samme.

Desuden planlægger vi at holde en midtvejsevaluering i løbet af semesteret, ligeledes i CampusNet.

Lektionsplan

Tirsdag 3/2 — Introduktion og Taksonomidatabaser

Forelæsninger:
  • Introduktion til kurset, bioinformatik og computere — Henrik Nielsen.
  • Evolution & Taksonomi — Rasmus Wernersson.
Pensum: Brief Introduction to Evolutionary Theory — Skrevet/redigeret af Anders Gorm Pedersen.
Slides: (Bliver lagt på CampusNet under "fildeling")
Test af forhåndskundskaber: Gå til "Evaluering" under CampusNet, klik på "Test af forhåndskundskaber" og udfyld skemaet (det er anonymt). Brug max. 10 minutter på det.
Øvelser:
  1. JEdit - (Svar til øvelsen)
  2. Taksonomidatabaser - (Svar til øvelsen)
AVANCERET EMNE (Ej pensum):
Phone 34.gif Tekstfiler på binært niveau (Video forelæsning, ~20mb, mpeg4 — Indlæst af Rasmus Wernersson, 2010)
Baggrundsmateriale:...
"Hvad er Bioinformatik?" — oversigtsartikel (PDF).

Tirsdag 10/2 — GenBank

Forelæsning: Biologisk information, DNA struktur og sekventering, søgning i Genbank — Rasmus Wernersson.
Pensum: DNA sequencing tutorial — kilde: IDT Tech Vault
Udleveret materiale: "Base-calling" øvelse [PDF], GenBank + FASTA format [PDF]
Slides: på CampusNet (under "fildeling")
Øvelse: Brug af GenBank databasen (svar til øvelsen)
Baggrundsmateriale (forudsættes kendt):
Phone 34.gif mRNA splicing (YouTube).
Oversigt over eukaryot gen-struktur (PDF).
Yderligere materiale (ej pensum):
Entrez Sequences Quick Start (NCBI)
Den årlige GenBank artikel, 2015 (PDF)

Tirsdag 17/2 — Translation og UniProt

Forelæsning: Proteiner: data og databaser — Henrik Nielsen.
Pensum: Virtual Ribosome — software artikel (PDF).
Slides: (bliver lagt på CampusNet)
Øvelser:
  1. Exercise: Translation - Virtual Ribosome (svar)
  2. Exercise: The protein database UniProt (svar)
Baggrundsmateriale (forudsættes kendt):
Protein, sekvens og strukturniveauer [PDF]
Oversigt over eukaryot gen-struktur (PDF).
Phone 34.gif Aminosyrer og Proteiner — Kort videoforelæsning (16 min) med en genopfriskning af de vigtigste facts ang. aminosyrer og proteiner (Indlæst af Thomas Nordahl Petersen, 2010).
Yderligere materiale (ej pensum):
Den årlige UniProt artikel, 2015 (PDF)

Tirsdag 24/2 — Parvis Alignment

Forelæsning: Parvis alignment — Henrik Nielsen.
Pensum: Side 35-55 i Immunological Bioinformatics (PDF - på CampusNet: Fildeling → Uddrag af lærebog).
Slides: (På CampusNet).
Handout øvelse: Alignment scores
Øvelse: Parvis alignment — svar: Parvis alignment svar
AVANCERET EMNE (Ej pensum):
Phone 34.gif Video-klip: (Rasmus Wernersson, 2008): Detaljeret gennemgang af Dynamisk Programmering. - Mac/Windows (QuickTime/Mpeg4).
Ekstra materiale:
Phone 34.gif Optaget forelæsning: (kan bruges om reminder ang. dagens pensum — er på engelsk) Pairwise alignments + BLAST, Anders Gorm Pedersen 2010
login: viewer@cbs.dtu.dk - pass: jeglurer.
Starter med parvis alignment (dækker også dynamisk programmering) — bruger samme handout øvelse som I selv arbejdede med til vores forelæsning.

Tirsdag 3/3 — Proteinstruktur, PDB & PyMOL

Husk at medbringe en mus til øvelsen denne dag. Musen skal have tre knapper, hvoraf den midterste skal være et scroll-hjul.
Forelæsning: Protein 3D structure — Paolo Marcatili (NB: Forelæsningen vil foregå på engelsk)
Pensum: Protein Structure (Wikipedia - frosset version) - Link til "Live" version her.
Bonus-videoforelæsning: Phone 34.gif Online videoforelæsning (2010), Paolo Marcatili
Slides: På CampusNet
Link til avanceret kursus:
Andre relevante kurser:


Øvelse: Visualisering af proteinstrukturer i PyMOL - svar til Exercise 1: Svar (NB: afsnittet "PyMOL magic" er ikke pensum, blot et tip hvis I senere skal bruge PyMOL)
VIGTIGT - MacOS X 10.10: Her er en guide til at få PyMol til at virke på 10.10 (Yosemite): PyMol workaround

Tirsdag 10/3 — Databasesøgning med BLAST

Forelæsning: Introduktion til BLAST — Henrik Nielsen.
Pensum: sektion 3.2.5 → 3.3 (dvs. side 47-52) i Immunological Bioinformatics (PDF - på CampusNet: Fildeling → Uddrag af lærebog).
Slides: På CampusNet.
Øvelse: Exercise: BLAST — Svar til øvelsen: Blast svar
Ekstra materiale:
Phone 34.gif Optaget forelæsning: (kan bruges om reminder ang. dagens pensum - er på engelsk) Pairwise alignments + BLAST, Anders Gorm Pedersen 2010
login: viewer@cbs.dtu.dk - pass: jeglurer.
BLAST delen starter ca. 1:05 inde i optagelsen.
Phone 34.gif Videoer om BLAST fra NCBI: (Videointroduktion til NCBI's web interface og E-værdier/Expect Values) NCBI's YouTube channel

Tirsdag 17/3 — Malariavaccine

Forelæsning: Malaria og vacciner — Jakob Schmidt Jespersen.
Slides: På CampusNet
Baggrundsmateriale (bør læses før øvelsen):
Øvelse: Opsamlende computerøvelse: Udvikling af malariavaccine (svar)

Emblem-important tiny.png Husk midtvejsevaluering: Gå til CampusNet -> Evaluering. Emblem-important tiny.png


Tirsdag 24/3 — Multiple Alignments

Forelæsning: Multiple Alignments — Rasmus Wernersson
Pensum: RevTrans (artikel, PDF)
Handout: Lokalisering af CDS navne i GenBank (PDF)
Slides: På CampusNet.
Øvelse: Multiple Alignment — Svar : Multiple Alignment svar
Ekstra materiale:
Phone 34.gif Optaget forelæsning: Multiple Alignments, Anders Gorm Pedersen 2010
login: viewer@cbs.dtu.dk - pass: jeglurer

Tirsdag 7/4 — Fylogenetiske træer

Forelæsning: Fylogenetiske træer — Anders Gorm Pedersen.
Pensum: "Introduction to Treebuilding" (PDF på Campusnet). Evolutionary trees (minus afsnittet "How to reconstruct an evolutionary tree"), Understanding Evolutionary Trees.
Udleveret materiale: handout øvelse Rekonstruktion af afstandstræ
Slides: På CampusNet.
Link til avanceret kursus:
Software til installering: FigTree tree-viewer
Øvelse: Exercise: Phylogeny — Svar : Fylogenetiske træer

Tirsdag 14/4 — Sekvensinformation og LOGO-plots

Forelæsning: Sekvensinformation og LOGO-plots — Rasmus Wernersson.
Pensum:
  1. Side 68-80 i Immunological Bioinformatics (PDF - på CampusNet: Fildeling → Uddrag af lærebog).
  2. Side 1-8 af "Information theory primer" (PDF)
    • (Læs evt. også appendix'et om logaritmer (særligt om Log2), hvis du har brug for at genopfriske din viden).
Supplerende pensum: Konstruktion af Logo plots - Handout
Handouts til forelæsning:


Slides: På CampusNet.
Øvelse: DNA and Peptide LOGOs - svar: Answers to the LOGO plot exercise

Tirsdag 21/4 — Vægtmatricer og andre forudsigelsesmetoder

Forelæsning: Introduktion til forudsigelsesmetoder og vægtmatricer — Henrik Nielsen
Pensum: Samme som sidste uge.
Slides: På CampusNet.
Handouts til forelæsning:
Øvelse: Exercise: Construction of sequence logos and weight matrices Svar: Answers to exercise

Tirsdag 28/4 — Profilsøgning med PSI-BLAST

Forelæsning: PSI-BLAST — Bent Petersen.
Pensum: Samme som sidste uge.
Slides: På CampusNet.
Handouts til forelæsning: Alignment using sequence profiles
Øvelse: PSI-BLAST — Svar til øvelsen: PSI-BLAST answers

Tirsdag 5/5 — Bioinformatik i praksis + Øvelse: Gammelt eksamenssæt

Forelæsning: Bioinformatik i den virkelige verden — Bent Petersen
Gammelt eksamenssæt:

Spørgetime

Spørgetime — dato og tidspunkt aftales med deltagerne, så det ikke kolliderer med andre eksamenstidspunkter

Eksamen

Torsdag 28/5

SOMMEREKSAMEN 2015: Gå til CampusNet → Opgaver → Sommereksamen 2015
  • NB: der åbnes først for adgang fra klokken 9:00 den 28/5 2015.

Tjekliste til computere

Se her om din computer har alt det software der skal bruges til eksamen: Tjekliste til computere 27611

Linksamling

Samlet oversigt over de websites vi har brugt i kurset: Linksamling for 27611

Spørgsmål og svar

Spørgsmål der er blevet stillet pr. email, og lærernes svar på dem: FAQ for 27611