27611: Kursusplan for forår 2012

From teaching
Jump to: navigation, search

Generel information

Undervisere

Hjælpelærere

  • Anne Bresciani
  • Andreas Porse

Indhold

I dette kursus er der lagt en stor vægt på praktisk anvendelse af de bioinformatiske værktøjer. En typisk lektion vil blive indledt med en teoretisk gennemgang af dagens emne (incl. nogle mindre øvelser/gruppearbejde) på en lille times tid, og resten af tiden vil blive brugt til praktiske øvelser på computer.

Se i øvrigt kursusbasen om 27611.

Pensum

Udleverede noter og øvelsesmateriale: Der en ikke en formel lærebog. Der vil løbende blive udleveret kompendiemateriale; typisk i form af PDF filer på hjemmesiden. Vær opmærksom på at alle øvelsesvejledninger er pensum — og det gælder også svarene til øvelserne, som bliver lagt på hjemmesiden efter hver øvelsesgang!

Computere

I skal SELV medbringe bærbare computere der kan kobles til DTU's trådløse netværk. Typen af computer/Operativ System er ikke vigtigt — Windows, Mac og Linux vil alle virke fint.

Til øvelserne i "PDB & PyMol" samt "Malariavaccine" skal I medbringe en mus. Musen skal have tre knapper, hvoraf den miderste skal være et scroll-hjul.

Software:

  1. En moderne Internet Browser (fx. Google Chrome, FireFox, Opera, Safari eller Internet Explorer). NB: Du skal have enten FireFox, Chrome eller Opera på dit system, da Internet Explorer (Windows) og Safari (Mac) kan have knas med visse bioinformatik-websites.
  2. JAVA: JAVA kan hentes gratis her: http://www.java.com — ofte vil det allerede være installeret på din computer.
  3. JEdit: I kurset vil vi flere gange bruge JEdit til at kigge på tekst-baserede sekvensfiler — du kan med fordel installere den før første kursus-gang (gratis program): http://www.jedit.org.

Øvrig software installeres i løbet af øvelserne.

Hvor og hvornår

Kurset består af forelæsning + efterfølgende øvelser. Forelæsninger afholdes tirsdage fra 13:00-14:00 (cirka) i bygning 208, auditorium 51. Øvelserne afholdes efterfølgende i rum 112+118+108+110 i bygn. 210.

Første undervisningsgang er tirsdag den 31. januar.

Afleveringer

Som træning til den computer-baserede eksamen, skal hver gruppe skrive en "logbog" med svar på de spørgsmål der stilles i øvelserne (man må gerne skrive på dansk selv om teksten i øvelserne er på engelsk). Efter øvelsen skal I upload'e jeres svar til CampusNet (Kursus 27611 -> Afleveringer).

I kan med fordel bruge en helt almindelig tekst-editor (fx. JEdit som vi introducerer første dag), og ikke bruge en masse kræfter på fancy formatering. Det vigtige er at adskille de enkelte svar, så det er let at læse. Et eksempel kunne være:

   Svar på Multiple Alignment øvelse
   ---------------------------------
   Af: Rasmus Wernersson (v18013)
   
   Spørgsmål 1
   -----------
   Fasta fil:
   
   >goat_alpha_globin_II
   ATGGTGCTGTCTGCCGCCGACAAGTCCAATGTCAAGGCCGCCTGGGGCAAGGTTGGCAGCAACGCTGGAG
   CTTATGGCGCAGAGGCTCTGGAGAGGATGTTCCTGAGCTTCCCCACCACCAAGACCTACTTCCCCCACTT
   CGACCTGAGCCACGGCTCGGCCCAGGTCAAGGGCCACGGCGAGAAGGTGGCCGCCGCGCTGACCAAAGCG
   GTGGGCCACCTGGACGACCTGCCCGGTACTCTGTCTGATCTGAGTGACCTGCACGCCCACAAGCTGCGTG
   TGGACCCGGTCAACTTTAAGCTTCTGAGCCACTCCCTGCTGGTGACCCTGGCCTGCCACCACCCCAGTGA
   TTTCACCCCCGCGGTCCACGCCTCCCTGGACAAGTTCTTGGCCAACGTGAGCACCGTGCTGACCTCCAAA
   TACCGTTAA
   >xxx_yyy_qqq
   ATAGATAGT ....
   
   
   Spørgsmål 2
   -----------
   2a): xxxx yyyy zzzz
   2b): ddd jjj uuu


NB: Afleveringerne har ikke nogen indflydelse på jeres karakter — det er ren øvelse i brug af det system vi også skal bruge til eksamen.

CampusNet

Link til CampusNet gruppe for dette års kursus: https://www.campusnet.dtu.dk/cnnet/element/index.aspx?elementid=370979

Løbende evaluering og feedback

Kursus 27611 på Bio-Evaluering.dk

Lektionsplan

Tirsdag 31/1 — Introduktion og Taksonomidatabaser

Forelæsninger:
  • Introduktion til kurset, bioinformatik og computere — Henrik Nielsen.
  • Evolution & Taksonomi — Rasmus Wernersson.
Pensum: Brief Introduction to Evolutionary Theory — Skrevet/redigeret af Anders Gorm Pedersen.
Slides: (Bliver lagt på CampusNet under "fildeling")
Øvelser:
  1. JEdit - (Svar til øvelsen)
  2. Taksonomidatabaser - (Svar til øvelsen)
AVANCERET EMNE (Ej pensum):
Phone 34.gif Tekstfiler på binært niveau (Video forelæsning, ~20mb, mpeg4 — Indlæst af Rasmus Wernersson, 2010)
Baggrundsmateriale:...
"Hvad er Bioinformatik?" — oversigtsartikel (PDF).

Tirsdag 7/2 — GenBank

Forelæsning: Biologisk information, DNA struktur og sekventering, søgning i Genbank — Henrik Nielsen.
Pensum: DNA sequencing tutorial — kilde: IDT Tech Vault
Udleveret materiale: "Base-calling" øvelse [PDF], GenBank + FASTA format [PDF]
Slides: på CampusNet (under "fildeling")
Øvelse: Brug af GenBank databasen - (svar til øvelsen)
Baggrundsmateriale:
Phone 34.gif mRNA splicing (YouTube).
Oversigt over eukaryot gen-struktur (PDF).

Tirsdag 14/2 — Translation og UniProt

Forelæsning: Proteiner: data og databaser — Henrik Nielsen.
Pensum: Virtual Ribosome — software artikel (PDF).
Slides: (bliver lagt på CampusNet)
Øvelser:
  1. Exercise: Translation - Virtual Ribosome (svar)
  2. Exercise: The protein database UniProt (svar)
Baggrundsmateriale (forudsættes kendt):
Protein, sekvens og strukturniveauer [PDF]
Oversigt over eukaryot gen-struktur (PDF).
Phone 34.gif Aminosyrer og Proteiner — Kort videoforelæsning (16 min) med en genopfriskning af de vigtigste facts ang. aminosyrer og proteiner (Indlæst af Thomas Nordahl Petersen, 2010).

Tirsdag 21/2 — Parvis Alignment

Forelæsning: Parvis alignment — Henrik Nielsen.
Pensum: Side 35-55 i Immunological Bioinformatics (PDF - på CampusNet: Fildeling -> Uddrag af lærebog).
Slides: (På CampusNet).
Handout øvelse: Alignment scores
Øvelse: Parvis alignment - svar: Parvis alignment svar
AVANCERET EMNE (Ej pensum):
Phone 34.gif Video-klip: (Rasmus Wernersson, 2008): Detaljeret gennemgang af Dynamisk Programmering. - Mac/Windows (QuickTime/Mpeg4).
Ekstra materiale:
Phone 34.gif Optaget forelæsning: (kan bruges om reminder ang. dagens pensum — er på engelsk) Pairwise alignments + BLAST, Anders Gorm Pedersen 2010
login: viewer@cbs.dtu.dk - pass: jeglurer.
Starter med parvis alignment (dækker også dynamisk programmering) — bruger samme handout øvelse som I selv arbejdede med til vores forelæsning.

Tirsdag 28/2 — Proteinstruktur, PDB & PyMOL

Husk at medbringe en mus til øvelsen denne dag. Musen skal have tre knapper, hvoraf den midterste skal være et scroll-hjul.
Forelæsning: Protein 3D struktur — Thomas Holberg Blicher
Pensum: Protein Structure (Wikipedia - frosset version) - Link til "Live" version her.
Bonus-videoforelæsning: Phone 34.gif Online videoforelæsning (2010), Thomas Holberg Blicher
Slides: På CampusNet
Links til avancerede kurser:
Andre relevante kurser:
Øvelse: Visualisering af proteinstrukturer i PyMOL - svar til Exercise 1: PDF (NB: afsnittet "PyMOL magic" er ikke pensum, blot et tip hvis I senere skal bruge PyMOL)

Tirsdag 6/3 — Malariavaccine

Forelæsning: Malaria og vacciner — Thomas Salhøj Rask.
Slides: På CampusNet
Øvelse: Design af malariavaccine (opsamlende øvelse med de emner der er gennemgået indtil videre) (svar)

Tirsdag 13/3 — Databasesøgning med BLAST

Forelæsning: Introduktion til BLAST — Rasmus Wernersson.
Pensum: sektion 3.2.5 -> 3.3 (dvs. side 47 - 52) i Immunological Bioinformatics (PDF - på CampusNet: Fildeling -> Uddrag af lærebog).
Slides: På CampusNet.
Øvelse: BLAST - Svar til øvelsen: Blast svar
Ekstra materiale:
Phone 34.gif Optaget forelæsning: (kan bruges om reminder ang. dagens pensum - er på engelsk) Pairwise alignments + BLAST, Anders Gorm Pedersen 2010
login: viewer@cbs.dtu.dk - pass: jeglurer.
BLAST delen starter ca. 1:05 inde i optagelsen.

Tirsdag 20/3 — Multiple Alignments

Forelæsning: Multiple Alignments — Henrik Nielsen
Pensum: RevTrans (artikel, PDF)
Handout: Lokalisering af CDS navne i GenBank (PDF)
Slides: På CampusNet.
Øvelse: Multiple Alignment - Svar : Multiple Alignment svar
Ekstra materiale:
Phone 34.gif Optaget forelæsning: Multiple Alignments, Anders Gorm Pedersen 2010
login: viewer@cbs.dtu.dk - pass: jeglurer

Tirsdag 27/3 — Fylogenetiske træer

Forelæsning: Fylogenetiske træer — Anders Gorm Pedersen.
Pensum: "Introduction to Treebuilding" (PDF på Campusnet). Evolutionary trees (minus afsnittet "How to reconstruct an evolutionary tree").
Udleveret materiale: handout øvelse Rekonstruktion af afstandstræ
Slides: På CampusNet.
Software til installering: FigTree tree-viewer
Øvelse: Exercise: Phylogeny Svar : Fylogenetiske træer

Tirsdag 10/4 — LOGO-plots & vægtmatricer

Forelæsning: LOGO'er og vægtmatricer — Morten Nielsen.
Pensum: Side 68-80 i Immunological Bioinformatics (PDF - på CampusNet: Fildeling -> Uddrag af lærebog).
Supplerende pensum: Konstruktion af Logo plots - Handout
Handouts til forelæsning:
Slides: På CampusNet.
Øvelse: Sequence logos and weight matrices Svar: Answers to exercise

Tirsdag 17/4 — Profilsøgning med PSI-BLAST

Forelæsning: PSI-BLAST — Morten Nielsen.
Pensum: Samme som sidste uge.
Slides: På CampusNet.
Handouts til forelæsning: Alignment using sequence profiles
Øvelse: PSI-BLAST - Svar til øvelsen: PSI-BLAST answers

Tirsdag 24/4 — Forudsigelsesmetoder

Forelæsning 1: Introduktion til forudsigelsesmetoder — Henrik Nielsen
Forelæsning 2: Bioinformatik i den virkelige verden — Rasmus Wernersson, Intomics A/S
Slides: På CampusNet.
Øvelse: Prediction MethodsSvar

Tirsdag 8/5 — Øvelse: Gammelt eksamenssæt

Ingen forelæsning — vi mødes kl. 13 i øvelseslokalerne.
Sidste års eksamen:
Bemærk: Visse detaljer i svarene (f.eks. E-værdier) har ændret sig siden sidste år, fordi databaserne er blevet opdateret siden dengang. Opdaterede svar for Opgave 3 del 2 er:
f) Escherichia coli: 10583, Bacillus subtilis: 319
g) Escherichia coli: 235, Bacillus subtilis: 43

Spørgetime

Spørgetime — tirsdag den 15. maj kl. 13

Eksamen

Onsdag 23/5

EKSAMEN 2012:
  • NB: der åbnes først for adgang fra klokken 9:00 den 23/5 2012.
  • Genopfrisk (reload - ofte F5 under Windows) denne side for at se link'et til eksamensopgaverne
SOMMEREKSAMEN 2012: Eksamen2012final.pdf

Tjekliste til computere

Se her om din computer har alt det software der skal bruges til eksamen: Tjekliste til computere 27611

Linksamling

Samlet oversigt over de websites vi har brugt i kurset: Linksamling for 27611

Spørgsmål og svar

Spørgsmål der er blevet stillet pr. email, og lærernes svar på dem: FAQ for 27611